nkx3.3

Ensembl ID:
ENSDARG00000069327
ZFIN ID:
ZDB-GENE-050306-27
Description:
NK3 homeobox 3 [Source:RefSeq peptide;Acc:NP_001013342]
Human Orthologue:
NKX3-2
Human Description:
NK3 homeobox 2 [Source:HGNC Symbol;Acc:951]
Mouse Orthologue:
Nkx3-2
Mouse Description:
NK3 homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:108015]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17199 Nonsense Available for shipment Available now
sa9663 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128951 Nonsense 64 240 1 2
Genomic Location (Zv9):
Chromosome 13 (position 40749128)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40275574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGAGCCGAAAGCGCACAGACGCGCATCTCTTCCTGCGTGCTCGTGCTC[G/T]AGTCTTTATCATYAGAYCAGCATTCATGCGAGGAAGAATCAACAGRAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128951 Nonsense 87 240 1 2
Genomic Location (Zv9):
Chromosome 13 (position 40749059)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40275505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCATTCATGCGAGGAAGAATCAACAGRAGAAGATAATTCACTGGRAAGG[C/T]GACATGGTGAGACATTAACATCACTTCAGGTGTACGATGTAATGTTGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link