mus81

Ensembl ID:
ENSDARG00000069326
ZFIN ID:
ZDB-GENE-040426-2923
Description:
Crossover junction endonuclease MUS81 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXA9]
Human Orthologue:
MUS81
Human Description:
MUS81 endonuclease homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29814]
Mouse Orthologue:
Mus81
Mouse Description:
MUS81 endonuclease homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918961]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16723 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100779 Nonsense 593 603 18 18
ENSDART00000100782 Nonsense 602 612 17 17
ENSDART00000142970   None 137 None 4

The following transcripts of ENSDARG00000069326 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 21037703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTATTTGTYTGTAGGAATCTTGGACCAGCATTAAGCCKCACGATATA[T/G]YAGCTTTACTGTACTCGTGGACCTTTGTCATAGGATTTTACATTGCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ucyrhjgf