mus81

Ensembl ID:
ENSDARG00000069326
ZFIN ID:
ZDB-GENE-040426-2923
Description:
Crossover junction endonuclease MUS81 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXA9]
Human Orthologue:
MUS81
Human Description:
MUS81 endonuclease homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29814]
Mouse Orthologue:
Mus81
Mouse Description:
MUS81 endonuclease homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918961]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16723 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100779 Nonsense 593 603 18 18
ENSDART00000100782 Nonsense 602 612 17 17
ENSDART00000142970 None None 137 None 4

The following transcripts of ENSDARG00000069326 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 21037703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTATTTGTYTGTAGGAATCTTGGACCAGCATTAAGCCKCACGATATA[T/G]YAGCTTTACTGTACTCGTGGACCTTTGTCATAGGATTTTACATTGCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ucyrhjgf