fam169b

Ensembl ID:
ENSDARG00000069321
ZFIN ID:
ZDB-GENE-050419-217
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LWJ5]
Human Orthologue:
FAM169B
Human Description:
family with sequence similarity 169, member B [Source:HGNC Symbol;Acc:26835]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23290 Nonsense Mutation detected in F1 DNA During 2014
sa11717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100776 Nonsense 148 344 5 9
ENSDART00000141739 Nonsense 89 220 3 5
Genomic Location:
Chromosome 18 (position 20842385)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTATTCCTGCTCAGCCAAGTTATATTTGGGATTCTGGAAAGGCCTCTT[G/T]AAGATGACCTATATTTTTCTGCCTATTCTTTGAGGGAACATGGCAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100776 Nonsense 258 344 7 9
ENSDART00000141739 Nonsense 199 220 5 5
Genomic Location:
Chromosome 18 (position 20844027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGCAAGAAGTATCTTGAGSTCCATGAAAAAGAAARAGAGCGTCTCTA[T/G]GAAGTGGAAGCCCCTGGTGAATGGCCTCAGAGAYGTAATGTGTGGTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/inwjk9kn