fam169b

Ensembl ID:
ENSDARG00000069321
ZFIN ID:
ZDB-GENE-050419-217
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LWJ5]
Human Orthologue:
FAM169B
Human Description:
family with sequence similarity 169, member B [Source:HGNC Symbol;Acc:26835]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23290 Nonsense Mutation detected in F1 DNA During 2016
sa43095 Nonsense Mutation detected in F1 DNA During 2016
sa11717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100776 Nonsense 148 344 5 9
ENSDART00000141739 Nonsense 89 220 3 5
Genomic Location (Zv9):
Chromosome 18 (position 20842385)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21072608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTATTCCTGCTCAGCCAAGTTATATTTGGGATTCTGGAAAGGCCTCTT[G/T]AAGATGACCTATATTTTTCTGCCTATTCTTTGAGGGAACATGGCAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100776 Nonsense 246 344 7 9
ENSDART00000141739 Nonsense 187 220 5 5
Genomic Location (Zv9):
Chromosome 18 (position 20843991)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21074214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGTTTACACGACTTGTTAAAATAATGGTTTACAGTGTGCAAGAAGTA[T/A]CTTGAGGTCCATGAAAAAGAAAGAGAGCGTCTCTATGAAGTGGAAGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100776 Nonsense 258 344 7 9
ENSDART00000141739 Nonsense 199 220 5 5
Genomic Location (Zv9):
Chromosome 18 (position 20844027)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21074250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGCAAGAAGTATCTTGAGSTCCATGAAAAAGAAARAGAGCGTCTCTA[T/G]GAAGTGGAAGCCCCTGGTGAATGGCCTCAGAGAYGTAATGTGTGGTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link