efr3bb

Ensembl ID:
ENSDARG00000069318
ZFIN ID:
ZDB-GENE-041014-293
Description:
Protein EFR3 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q5SPP5]
Human Orthologue:
EFR3B
Human Description:
EFR3 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:29155]
Mouse Orthologue:
Efr3b
Mouse Description:
EFR3 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2444851]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43518 Nonsense Mutation detected in F1 DNA During 2017
sa37134 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100761 Nonsense 42 816 3 23
ENSDART00000134855 Nonsense 42 816 4 24
Genomic Location (Zv9):
Chromosome 20 (position 42951348)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43022507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTACAGGATGGCTTGGTCAAGGCCAACATGGAGAAACTGACTTTCTA[T/A]GCCCTGTCAGCTCCAGAGAAGCTGGATCGGATCGGGGCATACCTGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100761 Nonsense 72 816 4 23
ENSDART00000134855 Nonsense 72 816 5 24
Genomic Location (Zv9):
Chromosome 20 (position 42951543)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43022702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCACTCTTGATACTTCCTGTATTGAGTGTGTGTTTGTCTTTTCAGGTA[T/A]GTGTGTATTGCGATGGAAGCTCTTGACCAGCTTCTAATGGCCTGCCACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link