oxa1l

Ensembl ID:
ENSDARG00000069313
ZFIN IDs:
ZDB-GENE-070410-140, ZDB-GENE-071004-49
Description:
mitochondrial inner membrane protein OXA1L [Source:RefSeq peptide;Acc:NP_001098600]
Human Orthologue:
OXA1L
Human Description:
oxidase (cytochrome c) assembly 1-like [Source:HGNC Symbol;Acc:8526]
Mouse Orthologue:
Oxa1l
Mouse Description:
oxidase assembly 1-like Gene [Source:MGI Symbol;Acc:MGI:1916339]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40860 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100757 Essential Splice Site 429 469 9 10
Genomic Location (Zv9):
Chromosome 7 (position 20748678)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19339114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGAGAGAAAGGAGAATTAAAGGACACCTCGATATTGCAGCCAAAG[G/A]TGAGGCTTTACTTTATACTTCTGTTTCATAACCTAGTGAGCCTTTTAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link