pomcb

Ensembl ID:
ENSDARG00000069307
ZFIN ID:
ZDB-GENE-041014-294
Description:
proopiomelanocortin b [Source:RefSeq peptide;Acc:NP_001076520]
Human Orthologue:
POMC
Human Description:
proopiomelanocortin [Source:HGNC Symbol;Acc:9201]
Mouse Orthologue:
Pomc
Mouse Description:
pro-opiomelanocortin-alpha Gene [Source:MGI Symbol;Acc:MGI:97742]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23794 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100751 Nonsense 58 215 2 2
Genomic Location (Zv9):
Chromosome 20 (position 43001024)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43072183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGTGTCTCAGAAAGTGCAGATCGGACCAAGAATCTTCCAGAAACATC[A/T]GAGTTTCTTCATCTGAACATCAGAGCAGTGAAGAACAGGTAGAGGAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)
  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link