si:ch211-203k16.3

Ensembl ID:
ENSDARG00000069305
ZFIN ID:
ZDB-GENE-041014-290
Description:
Novel protein similar to vertebrate angiopoietin-like protein family [Source:UniProtKB/TrEMBL;Acc:Q5
Human Orthologue:
FGL2
Human Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Mouse Orthologue:
Fgl2
Mouse Description:
fibrinogen-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:103266]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37135 Nonsense Mutation detected in F1 DNA During 2017
sa37136 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37137 Nonsense Mutation detected in F1 DNA During 2017
sa15152 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100749 Nonsense 86 425 1 6
ENSDART00000138793   None 232 None 4

The following transcripts of ENSDARG00000069305 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 43025960)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43097119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTACAGATGAGGTGTCATACTGGCTTCATGAGAACGAAGAGCGCAAA[C/T]AGCAGATCCTAGCACTCAAGGAGACCGTTTCTGAATTGCAGGAGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100749 Essential Splice Site 194 425 3 6
ENSDART00000138793   1 232 1 4

The following transcripts of ENSDARG00000069305 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 43036048)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43107207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTTTGGTTTTCTTTATGTTAATATATCTGTATGTGCTTTTGACTTC[A/G]GAGGTGCAGAATGTTAGGAACTGTCCCATCGACTGTGCCTCCATCTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100749 Nonsense 275 425 4 6
ENSDART00000138793 Nonsense 82 232 2 4

The following transcripts of ENSDARG00000069305 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 43038100)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43109259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAAGGAGTATAAAGAGGGATTTGGAGACCTGCACACCGAATACTG[G/A]CTGGGAAATGAGCACATCCACGATCTGACCAGTCAGGGAGATTACATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100749 Essential Splice Site 312 425 5 6
ENSDART00000138793 Essential Splice Site 119 232 3 4

The following transcripts of ENSDARG00000069305 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 43040988)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43112147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGGTGTCTTGRTTATGAGATTGGTGGTAATGRATGGTGTGTGTTTCA[G/T]TGTGGAGGATGAGAACACTCAGTACCGTCTGCATGTGTCGGGCTTCAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link