osbpl9

Ensembl ID:
ENSDARG00000069298
ZFIN ID:
ZDB-GENE-061110-103
Description:
oxysterol-binding protein-related protein 9 [Source:RefSeq peptide;Acc:NP_001071273]
Human Orthologue:
OSBPL9
Human Description:
oxysterol binding protein-like 9 [Source:HGNC Symbol;Acc:16386]
Mouse Orthologue:
Osbpl9
Mouse Description:
oxysterol binding protein-like 9 Gene [Source:MGI Symbol;Acc:MGI:1923784]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21238 Nonsense Available for shipment Available now
sa21237 Nonsense Available for shipment Available now
sa21236 Nonsense Available for shipment Available now
sa31638 Essential Splice Site Available for shipment Available now
sa6094 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100727 Nonsense 172 733 8 24
ENSDART00000135319 Nonsense 75 239 5 10
ENSDART00000146774   None 52 None 4

The following transcripts of ENSDARG00000069298 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 17162857)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16607745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGTTTTGCTTTTTTTTTTAGAATATGGTAGAGTCCATCAAACACTG[T/A]ATCGTACTGCTACAGATTGCCAAGGTAAAACACTTGTAATTTAGACTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100727 Nonsense 204 733 10 24
ENSDART00000135319 Nonsense 107 239 7 10
ENSDART00000146774   None 52 None 4

The following transcripts of ENSDARG00000069298 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 17158807)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16603695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCTGTGGTTCTCCGCAGAGCACCATAAACCCAGTGGATGGGGTATTC[C/T]AGCCTACCCCTCTCAACGCCGCTGTAGTCAGTGCTAGTGCCATGCCAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100727 Nonsense 298 733 12 24
ENSDART00000135319 Nonsense 201 239 9 10
ENSDART00000146774   None 52 None 4

The following transcripts of ENSDARG00000069298 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 17152185)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16597073
KASP Assay ID:
2260-0345.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCACACTGTTCCCGACTTCTCCTATTCCAGCAGCGAAGACGAGTTTTA[C/A]GACGCAGATGAGTTTTATCAGAACAGCACGTCACCAAAACACTGCATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100727 Essential Splice Site 419 733 15 24
ENSDART00000135319   None 239 None 10
ENSDART00000146774   None 52 None 4

The following transcripts of ENSDARG00000069298 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 17147775)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16592663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAAATGTATGCAGATTTCTTTGCACACCCGGATTTGTTTGTAAGG[T/C]AATGCTTGTCTTCAGATCTCACAGCTGCTCTGCCATATGGACTTGATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100727 Nonsense 553 733 19 24
ENSDART00000135319   None 239 None 10
ENSDART00000146774   None 52 None 4

The following transcripts of ENSDARG00000069298 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 17142571)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16587459
KASP Assay ID:
554-3901.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATCCACTCTTGTCTACCATAGGTTGCGTGTCTTGTCTTGAATATGAT[G/T]AGCATTATATTCTTAATTTTCCCAATGGCTACGGGAGGTAAGGGTCGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link