upf3a

Ensembl ID:
ENSDARG00000069297
ZFIN ID:
ZDB-GENE-060721-2
Description:
Regulator of nonsense transcripts 3A [Source:UniProtKB/Swiss-Prot;Acc:B0S733]
Human Orthologue:
UPF3A
Human Description:
UPF3 regulator of nonsense transcripts homolog A (yeast) [Source:HGNC Symbol;Acc:20332]
Mouse Orthologue:
Upf3a
Mouse Description:
UPF3 regulator of nonsense transcripts homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914281]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18954 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11009 Essential Splice Site Available for shipment Available now
sa21535 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100728 Essential Splice Site 80 452 2 10
ENSDART00000123005 Essential Splice Site 80 427 2 11
ENSDART00000139608 Essential Splice Site 80 478 2 11
ENSDART00000100728 Essential Splice Site 80 452 2 10
ENSDART00000123005 Essential Splice Site 80 427 2 11
ENSDART00000139608 Essential Splice Site 80 478 2 11

The following transcripts of ENSDARG00000069297 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 35884353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCTCTTCCATCTTTTGACTATTTTGAGTTCTTTCCTGCTGATCAGAG[G/A]TATGTCCACTTTGTTTATATAGAAATACTATGATCATGAGTGCTGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100728 Essential Splice Site 80 452 2 10
ENSDART00000123005 Essential Splice Site 80 427 2 11
ENSDART00000139608 Essential Splice Site 80 478 2 11
ENSDART00000100728 Essential Splice Site 80 452 2 10
ENSDART00000123005 Essential Splice Site 80 427 2 11
ENSDART00000139608 Essential Splice Site 80 478 2 11

The following transcripts of ENSDARG00000069297 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 35884353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCTCTTCCATCTTTTGACTATTTTGAGTTCTTTCCTGCTGATCAGAG[G/A]TATGTCCACTTTSTTTATATAGAAATACTATGATCATGAGTGCTGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100728 Essential Splice Site 302 452 8 10
ENSDART00000123005 Essential Splice Site 277 427 9 11
ENSDART00000139608 Essential Splice Site 302 478 8 11

The following transcripts of ENSDARG00000069297 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 35879754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGGAAAAGCCTGGAGGACACACTAAGTCAAAGGATTCAAAGGATAAG[T/G]AAGAGCTTCCTAAAACTTACCCCTTCTTGAAAAGATATGAGTTAAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/38jv7lbx