moxd1l

Ensembl ID:
ENSDARG00000069296
ZFIN ID:
ZDB-GENE-060126-3
Description:
DBH-like monooxygenase protein 2 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08CS6]
Mouse Orthologue:
Moxd2
Mouse Description:
monooxygenase, DBH-like 2 Gene [Source:MGI Symbol;Acc:MGI:2388042]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11964 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039017 Nonsense 515 572 12 13
ENSDART00000139014 Nonsense 507 564 12 13
Genomic Location:
Chromosome 20 (position 43137601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACGATGGCTTGGAATGACAGCTCTATCARTGAATACCAACAAACACTC[A/T]AGAAAATCAACCAGACAGTCATAGTYGTGRATTCATTTGTAAGCRTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dd4mkln9