bcl6ab

Ensembl ID:
ENSDARG00000069295
ZFIN ID:
ZDB-GENE-030131-7523
Description:
B-cell CLL/lymphoma 6a, genome duplicate b [Source:RefSeq peptide;Acc:NP_001093544]
Human Orthologue:
BCL6
Human Description:
B-cell CLL/lymphoma 6 [Source:HGNC Symbol;Acc:1001]
Mouse Orthologue:
Bcl6
Mouse Description:
B-cell leukemia/lymphoma 6 Gene [Source:MGI Symbol;Acc:MGI:107187]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11043 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079660 Nonsense 69 616 2 11
ENSDART00000138081 Nonsense 69 565 3 9
Genomic Location:
Chromosome 2 (position 9884644)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAGTGGCCTCTTTTACTCCATGTTTGCAGACARTCCTAAAAGCAACT[T/A]AAGCCTCATAAGTTTAGATCCAAAGGTGGACCCTGATGGCTTTGCCATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y3yh0sks