si:ch73-252g14.4

Ensembl ID:
ENSDARG00000069293
ZFIN ID:
ZDB-GENE-030131-1133
Description:
si:ch73-252g14.4 [Source:RefSeq peptide;Acc:NP_001093499]
Human Orthologue:
AHSG
Human Description:
alpha-2-HS-glycoprotein [Source:HGNC Symbol;Acc:349]
Mouse Orthologue:
Ahsg
Mouse Description:
alpha-2-HS-glycoprotein Gene [Source:MGI Symbol;Acc:MGI:107189]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8596 Nonsense Mutation detected in F1 DNA During 2017
sa1801 Missense F2 line generated During 2017
sa19684 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100725 Nonsense 64 386 1 7
Genomic Location (Zv9):
Chromosome 2 (position 9923532)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10336815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAACRGGTTCCTGGGCGCAGGGGGTACAGACCACYGTCAACTTGGCT[G/T]AATGTGATTCTCCAGAGGCTGAAGCAGCAGCTCTTGCAGCACAAGATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1801
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100725 Missense 161 386 3 7
Genomic Location (Zv9):
Chromosome 2 (position 9924943)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10338226
KASP Assay ID:
554-1793.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATTGTGATTTTGCTGTGACTAAAGGCCTGTCMATTGTGGCATTCAA[G/T]TGTAAAACTGAGATTGGTAAGAAGAAACAAAACAAAAACCAAACAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100725 Essential Splice Site 218 386 4 7
Genomic Location (Zv9):
Chromosome 2 (position 9925293)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10338576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTAAAGACAAAGTTTGCACTCTTTGAAATTGGACGAATGACATCTCAG[G/A]TAGGATAATAAATGAAAATAATGTATTGAAATAATAAATAAATCTCATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link