LOC100331504

Ensembl ID:
ENSDARG00000069291
Human Orthologue:
KIAA1024
Human Description:
KIAA1024 [Source:HGNC Symbol;Acc:29172]
Mouse Orthologue:
AF529169
Mouse Description:
cDNA sequence AF529169 Gene [Source:MGI Symbol;Acc:MGI:2667167]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34008 Nonsense Mutation detected in F1 DNA During 2017
sa34009 Nonsense Mutation detected in F1 DNA During 2017
sa34010 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100722 Nonsense 195 897 1 3
Genomic Location (Zv9):
Chromosome 7 (position 11178462)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 10111876
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAATGTAGGGCAGCCTCGCTGGATAAACTACAGCATCTGCCACAGTA[T/A]GCCAGTGTCAGTCCTCCTCCGTGCGAGATGCAGAGCACTTACTTCCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100722 Nonsense 265 897 1 3
Genomic Location (Zv9):
Chromosome 7 (position 11178671)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 10112085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAAGCGGAATATCTTCAAAGAGGATTTCCACAACCTTGTTGCCTTTT[C/A]GCCCCATGTGATCACCACGGAGTGCAGAGCGAATCCCAAATCTGGTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100722 Nonsense 473 897 1 3
Genomic Location (Zv9):
Chromosome 7 (position 11179294)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 10112708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTCAAGTAATGTGGACAACGGCATGAGTGTCGGGACTCAGACGGAA[C/T]AACATGAGTCCAGGAAGGTGAAAGATTATCCCAGTCAAAACAAATTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link