bida

Ensembl ID:
ENSDARG00000069290
ZFIN ID:
ZDB-GENE-050419-35
Description:
BH3 interacting domain death agonist [Source:RefSeq peptide;Acc:NP_001073295]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10083 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100716 Essential Splice Site 126 187 3 3
Genomic Location:
Chromosome 18 (position 20352675)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTACGCGAATGGTTCCTCCATTTAAATAGTATCACTTGCATRTTTWCA[G/C]GTTTGGGCCAGTCATCTATCTAAAGGAGTGCAGACGTTACTTCAGCATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iwnpb4bn