gabpa

Ensembl ID:
ENSDARG00000069289
ZFIN ID:
ZDB-GENE-011010-2
Description:
GA-binding protein alpha chain [Source:RefSeq peptide;Acc:NP_571662]
Human Orthologue:
GABPA
Human Description:
GA binding protein transcription factor, alpha subunit 60kDa [Source:HGNC Symbol;Acc:4071]
Mouse Orthologue:
Gabpa
Mouse Description:
GA repeat binding protein, alpha Gene [Source:MGI Symbol;Acc:MGI:95610]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34692 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100700 Nonsense 288 455 8 10
ENSDART00000100701 Nonsense 288 455 8 10
ENSDART00000140110   None 92 None 4

The following transcripts of ENSDARG00000069289 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35993877)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35213388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGCCACACCTACAGCCATTAAAGTGATGAAGCACAACAAAACACCA[C/T]GAGCCCCTCGCATCTCAGGAGAGGAGCGCAGTTCCCCAGGCAACCGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link