imp3

Ensembl ID:
ENSDARG00000069287
ZFIN ID:
ZDB-GENE-040426-1062
Description:
U3 small nucleolar ribonucleoprotein protein IMP3 [Source:RefSeq peptide;Acc:NP_956561]
Human Orthologue:
IMP3
Human Description:
IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) [Source:HGNC Symbol;Acc:14497]
Mouse Orthologue:
Imp3
Mouse Description:
IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916119]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2060 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa2060
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100709 Essential Splice Site 133 183 4 7
Genomic Location (Zv9):
Chromosome 2 (position 9776971)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10190254
KASP Assay ID:
554-3179.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCATGGCTCAGAACCTAAGGAACGCCATCACCTTCATTGAGCAGGGCC[G/A]TATCCTTCAATCACAAGTCTTGCTRATCTCTGCATATGTTCATATTCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link