ercc8

Ensembl ID:
ENSDARG00000069283
ZFIN ID:
ZDB-GENE-041010-60
Description:
DNA excision repair protein ERCC-8 [Source:RefSeq peptide;Acc:NP_001005984]
Human Orthologue:
ERCC8
Human Description:
excision repair cross-complementing rodent repair deficiency, complementation group 8 [Source:HGNC S
Mouse Orthologue:
Ercc8
Mouse Description:
excision repaiross-complementing rodent repair deficiency, complementation group 8 Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10326 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100698 Splice Site, Nonsense 58 400 3 12
ENSDART00000134265 Splice Site, Nonsense 58 178 3 6

The following transcripts of ENSDARG00000069283 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 17260147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAATATATCTATACATGTGGTTAACGTCCAGCCTGTTTTGCATTCCAG[T/G]ATGCTGTCAGGCGGATCTGATGGCGTAATTGTGATTTATGACTTRGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5zlkfw27