trmt5

Ensembl ID:
ENSDARG00000069278
ZFIN ID:
ZDB-GENE-030131-5978
Description:
tRNA (guanine-N(1)-)-methyltransferase [Source:RefSeq peptide;Acc:NP_001139055]
Human Orthologue:
TRMT5
Human Description:
TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:23141]
Mouse Orthologue:
Trmt5
Mouse Description:
TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1923607]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2689 Nonsense F2 line generated During 2016
sa42236 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2689
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085989 Nonsense 6 480 1 5
Genomic Location (Zv9):
Chromosome 13 (position 31911477)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31557425
KASP Assay ID:
554-2768.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATAGAAATGACGTAGGATAAACGCGTGTTCACATGGCAGCAGTGTGG[A/T]GAAGGTGAGCTGTGGCAGTTTGTTTTTAATATAAGGATTAGGGTANNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085989 Essential Splice Site 7 480 2 5
Genomic Location (Zv9):
Chromosome 13 (position 31909830)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31555778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATTCTAGGTACACAGGCCATAACTCCATCTCTCTCTTTTTCACCAAC[A/C]GATCTGCCAGACTTTTCATCCTCCTGCAGAGACATCACAGTTGTACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link