si:dkey-197d18.2

Ensembl ID:
ENSDARG00000069276
ZFIN ID:
ZDB-GENE-041014-157
Description:
hypothetical protein LOC560200 [Source:RefSeq peptide;Acc:NP_001108157]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4924 Essential Splice Site, Missense F2 line generated During 2017

Mutation Details

Allele Name:
sa4924
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060177 Missense 77 460 2 8
ENSDART00000132463 Essential Splice Site None 295 1 6
Genomic Location (Zv9):
Chromosome 20 (position 43525548)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43596707
KASP Assay ID:
554-3532.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGAACAGATCAAGGTTCAGACTGAGGAACCGTCACTGGAGGAACCT[G/A]TTGATGGTCAGAGTGAAGAACCATCACTGGTAGAGCCTGTCACTGTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link