ighmbp2l

Ensembl ID:
ENSDARG00000069274
ZFIN ID:
ZDB-GENE-050419-258
Description:
DNA-binding protein SMUBP-2 [Source:RefSeq peptide;Acc:NP_001038365]
Human Orthologue:
IGHMBP2
Human Description:
immunoglobulin mu binding protein 2 [Source:HGNC Symbol;Acc:5542]
Mouse Orthologue:
Ighmbp2
Mouse Description:
immunoglobulin mu binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:99954]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23288 Nonsense Available for shipment Available now
sa9011 Nonsense Mutation detected in F1 DNA During 2017
sa6514 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060291 Nonsense 89 997 3 15
ENSDART00000100674   None 83 None 5
ENSDART00000145211   None 349 None 5
Genomic Location (Zv9):
Chromosome 18 (position 20310961)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20541184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATAATCGTCTTTTGTATTGTGCTTAAAGGTGATATTATAGGCTTGTA[T/A]CAGGCAGAGGGTCAGGCTCTGCCTACTCAGTTGGGGTCAGGTGTGGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060291 Nonsense 455 997 9 15
ENSDART00000100674   None 83 None 5
ENSDART00000145211   None 349 None 5
Genomic Location (Zv9):
Chromosome 18 (position 20306940)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20537163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTACCGTATGAACAGTGCCATCATGCAGTGGGCTTCAGAGCAGATGTA[T/A]CAGGGAAAACTCATTGCACATCCTTCAGTGGAGAAGCACTTGCTTAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060291 Nonsense 920 997 14 15
ENSDART00000100674   None 83 4 5
ENSDART00000145211 Nonsense 272 349 4 5
Genomic Location (Zv9):
Chromosome 18 (position 20299596)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20529819
KASP Assay ID:
554-5195.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAARTGCAAAGCCAGTGTSCTGACGCTAGGACAACTCTGCATTTACTG[T/A]AACAGACAGTACTGYTTGAGTCACCATATACCCGAGGTACAACTTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link