kbtbd4

Ensembl ID:
ENSDARG00000069271
ZFIN ID:
ZDB-GENE-040426-937
Description:
kelch repeat and BTB domain-containing protein 4 [Source:RefSeq peptide;Acc:NP_956503]
Human Orthologue:
KBTBD4
Human Description:
kelch repeat and BTB (POZ) domain containing 4 [Source:HGNC Symbol;Acc:23761]
Mouse Orthologue:
Kbtbd4
Mouse Description:
kelch repeat and BTB (POZ) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1914386]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36636 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100668 Nonsense 518 522 5 5
ENSDART00000128139 Nonsense 518 522 4 4
Genomic Location (Zv9):
Chromosome 18 (position 20270002)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20500225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGTGGTCTCTGTAATCAAGGGAATCAAAATCCTGCTCACGAACTGG[C/T]AGTTCGTACTGGCCTGAGATGTTTGATGTAATGCATGGGACCATAATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link