si:ch211-206k20.4

Ensembl ID:
ENSDARG00000069269
ZFIN ID:
ZDB-GENE-060810-148
Description:
WD repeat-containing protein 35 [Source:RefSeq peptide;Acc:NP_001139061]
Human Orthologue:
WDR35
Human Description:
WD repeat domain 35 [Source:HGNC Symbol;Acc:29250]
Mouse Orthologue:
Wdr35
Mouse Description:
WD repeat domain 35 Gene [Source:MGI Symbol;Acc:MGI:1921932]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22338 Essential Splice Site Available for shipment Available now
sa42238 Nonsense Mutation detected in F1 DNA During 2017
sa14117 Essential Splice Site Available for shipment Available now
sa35532 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Essential Splice Site 146 1203 5 29
ENSDART00000140099   None 213 None 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32847569)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32493517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGCATTGTGTATGAGGACGGTGCTGTGATTGTGGGCTCAGTGGATGG[T/C]AAACATTAATATAATCTTACTAATAGCAATACTATATATTTTTTTCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Nonsense 472 1203 14 29
ENSDART00000140099   None 213 None 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32841834)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32487782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGACAAAGACACACGTGATTGCTGCTTCTCGGGAGGCATTTTACATTT[G/A]GCAGTATCGTGTTGCAAAAAAACTCACCGCTCTTGAAATCAACCAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Essential Splice Site 539 1203 None 29
ENSDART00000140099   None 213 None 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32825953)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32471901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGATCCGATCTGCTGCATCACAGCATCAGACAAGATGCTCCTWGTGG[T/C]ATGTCYGATTTACGCAAGCACAYACTTTTACATCCCAAAGCTTCTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100663 Nonsense 619 1203 18 29
ENSDART00000140099   None 213 None 7

The following transcripts of ENSDARG00000069269 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 32825489)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32471437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCGGGTCTACAGCTGGAGACCCATCTAAATTTGAGCGCAAGGATGTCT[G/A]GGATATGAAATGGGCCAATGACAACCCAGATCTGTTCTCCATGATGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link