matn3b

Ensembl ID:
ENSDARG00000069265
ZFIN ID:
ZDB-GENE-050221-9
Description:
matrilin 3b [Source:RefSeq peptide;Acc:NP_001012385]
Human Orthologue:
MATN3
Human Description:
matrilin 3 [Source:HGNC Symbol;Acc:6909]
Mouse Orthologue:
Matn3
Mouse Description:
matrilin 3 Gene [Source:MGI Symbol;Acc:MGI:1328350]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24939 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100650 Nonsense 204 299 2 4
ENSDART00000100653 Nonsense 339 434 3 5
ENSDART00000100655 Nonsense 339 478 3 6
ENSDART00000145395 Nonsense 339 478 3 6
ENSDART00000146249 Nonsense 339 434 3 5
ENSDART00000148040 Nonsense 204 343 2 5
Genomic Location:
Chromosome 13 (position 32853702)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTCGAAGAGGTGTCAGCAGCAGCAAGGGCTTCTGGGATTGAAATATA[C/A]GCAGTAGGAGTGGACAGAGCAGAAATGCGGTCCCTCAAGCAGATGGCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/supeotab