metap2l

Ensembl ID:
ENSDARG00000069261
ZFIN ID:
ZDB-GENE-061013-5
Description:
methionine aminopeptidase 2 [Source:RefSeq peptide;Acc:NP_001093524]
Human Orthologue:
METAP2
Human Description:
methionyl aminopeptidase 2 [Source:HGNC Symbol;Acc:16672]
Mouse Orthologue:
Metap2
Mouse Description:
methionine aminopeptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1929701]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5265 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125767 Nonsense 146 468 5 11
Genomic Location:
Chromosome 4 (position 25097451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYGTGGTAACAGACGCAGTGCTGCGTGGAGAATGAGCGATGAGGAGAAG[C/T]GAGTACTGGATGAAGCCAATGAGGAGATGTGGAGTGATTTCAGACAGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4dgk80ab