uaca

Ensembl ID:
ENSDARG00000069250
ZFIN ID:
ZDB-GENE-050419-37
Description:
Novel protein similar to vertebrate uveal autoantigen with coiled-coil domains and ankyrin repeats (
Human Orthologue:
UACA
Human Description:
uveal autoantigen with coiled-coil domains and ankyrin repeats [Source:HGNC Symbol;Acc:15947]
Mouse Orthologue:
Uaca
Mouse Description:
uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:19198

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23283 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23284 Nonsense Mutation detected in F1 DNA During 2014
sa23285 Essential Splice Site, Missense Available for shipment Available now
sa7446 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100628 Essential Splice Site 111 561 5 17
ENSDART00000146957 Essential Splice Site 106 761 4 14
Genomic Location:
Chromosome 18 (position 19841848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGCTGCAGCCGGCGGTCACTCTGTGTGTGTGCAGAGTCTGCTGCAGG[T/C]ACGTGCATTATGTTTTCCCGCTAACAATTGCAGGAAGAAAGAGTAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100628 Nonsense 253 561 10 17
ENSDART00000146957 None None 761 None 14
Genomic Location:
Chromosome 18 (position 19850316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTAGTTTTTAAATCTTGTAGAAGATCCTCCCACGTGGTCTGTTTGTA[T/A]ACTGTGAAGCGTGCTCTATTGCACAGGTCTCAAACTGTAAAATTAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100628 Essential Splice Site 390 561 None 17
ENSDART00000146957 Missense 285 761 11 14
Genomic Location:
Chromosome 18 (position 19856867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAAGAGTGTGTTTTACTTTAACATTAGCCTTGTGAATTATTCAGGTC[A/G]GGCCCCCACAGTCGGCTCCAGCACCCGTGAGATCTGCCCCGATGGAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100628 None None 561 None 17
ENSDART00000146957 Missense 729 761 13 14
Genomic Location:
Chromosome 18 (position 19863402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTTTTTGCAGGAGTCTGGGAGGCATTACAGACATGTGCTTTCAGTA[T/A]ACAGAACACGGTTGCTCAGTGCAGCACAGGTAGCGTTTKACTTGCTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sl4pyyjl