si:ch73-131e21.7

Ensembl ID:
ENSDARG00000069249
ZFIN ID:
ZDB-GENE-030131-1437
Description:
aftiphilin [Source:RefSeq peptide;Acc:NP_001139033]
Human Orthologue:
AFTPH
Human Description:
aftiphilin [Source:HGNC Symbol;Acc:25951]
Mouse Orthologue:
Aftph
Mouse Description:
aftiphilin Gene [Source:MGI Symbol;Acc:MGI:1923012]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7414 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100630 Missense 403 793 1 9
ENSDART00000100631   None 390 None 2
ENSDART00000127068 Missense 157 537 2 11
ENSDART00000132727 Missense 403 793 2 10
Genomic Location (Zv9):
Chromosome 1 (position 55639523)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54422544
KASP Assay ID:
554-4339.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCWGCCTGAAGCGGCCGCAGAGAAAACTGAAGATGACGAATTTGRTGA[T/A]TTTGACACATCAAAAGAATTTAGTAAAACGGATTTGCCAGCTGAGGAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link