si:ch211-244b2.2

Ensembl ID:
ENSDARG00000069244
ZFIN IDs:
ZDB-GENE-030131-4737, ZDB-GENE-050208-562
Description:
hypothetical protein LOC557230 [Source:RefSeq peptide;Acc:NP_001076279]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14692 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100611 Nonsense 285 347 11 13
Genomic Location (Zv9):
Chromosome 4 (position 25172463)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26096132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAAGCTCGCTGGCAGTTTAAAGACATGGAYGGCAAATGGAAGGATTA[T/A]GTGAGAGTAAATGARCATTTACTAAACTTTCTCCAAATNTATTGTTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link