pdia5

Ensembl ID:
ENSDARG00000069242
ZFIN ID:
ZDB-GENE-030521-5
Description:
protein disulfide-isomerase A5 [Source:RefSeq peptide;Acc:NP_001107048]
Human Orthologue:
PDIA5
Human Description:
protein disulfide isomerase family A, member 5 [Source:HGNC Symbol;Acc:24811]
Mouse Orthologue:
Pdia5
Mouse Description:
protein disulfide isomerase associated 5 Gene [Source:MGI Symbol;Acc:MGI:1919849]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7634 Missense Mutation detected in F1 DNA During 2017
sa41480 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100592 Missense 193 528 8 17
ENSDART00000122797 Missense 206 541 8 17
Genomic Location (Zv9):
Chromosome 9 (position 38846906)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37984802
KASP Assay ID:
554-4309.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTACTAATGTTACTTTTACATCTCTTCTACTTGTAGGGTGTGGAGTA[T/A]GTAAAAGGATGCAGCCCATTTTCCAACAAGCAGCCACAGAGACTAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100592 Nonsense 431 528 14 17
ENSDART00000122797 Nonsense 444 541 14 17
Genomic Location (Zv9):
Chromosome 9 (position 38872618)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38010514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTCAGGGAATCGCTGAAAAAGAAGAAACACGCCTTGGTCATGTTTTA[T/A]GCTCCATGTAAGCCTTCTGTTTTTTCTAAAATACTGCAGCTGTAGTTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link