pcdh1g26

Ensembl ID:
ENSDARG00000069223
ZFIN ID:
ZDB-GENE-050609-21
Description:
protocadherin 1 gamma 26 [Source:RefSeq peptide;Acc:NP_001019295]
Human Orthologues:
PCDHGC4, PCDHGC5
Human Descriptions:
protocadherin gamma subfamily C, 4 [Source:HGNC Symbol;Acc:8717]
protocadherin gamma subfamily C, 5 [Source:HGNC Symbol;Acc:8718]
Mouse Orthologue:
Pcdhga11
Mouse Description:
protocadherin gamma subfamily A, 11 Gene [Source:MGI Symbol;Acc:MGI:1935228]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064522 Nonsense 665 808 1 1
Genomic Location (Zv9):
Chromosome 10 (position 21853763)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21831341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGGATATACTAATAGAGGAAGGGTTTCATGAGCCCATATCAGACTA[C/A]AGAGAGAAAACTATTGAGCCAAGTAAGAAAACAGGCAAAATTACACTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link