taar13e

Ensembl ID:
ENSDARG00000069201
ZFIN ID:
ZDB-GENE-041014-70
Description:
trace amine associated receptor 13e [Source:RefSeq peptide;Acc:NP_001076512]
Mouse Orthologue:
Taar4
Mouse Description:
trace amine-associated receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2685072]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12870 Nonsense Available for shipment Available now
sa4926 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa12870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100512 None None 326 None 6
ENSDART00000111317 Nonsense 231 341 1 1
Genomic Location:
Chromosome 20 (position 46152354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGRTTGGGTTGTATGCAAGGATTTTCATGATCGCTAAAAAGCATGCWAGA[A/T]AACTCGGTGAAGCAAACCAGCATGACAATGAAAATTTGTTCAAAAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4926
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100512 Nonsense 309 326 5 6
ENSDART00000111317 None None 341 None 1

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 46148151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCTTTTTCTACCCATGGTTTAGAAAAACCCTTTATCTCATTATAACA[A/T]GAAGAATATTTGAACCAAACTCATCTGATATCAATGTTTTCACTGTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fu4o4751