ETV6

Ensembl ID:
ENSDARG00000069193
Description:
ets variant 6 [Source:HGNC Symbol;Acc:3495]
Human Orthologue:
ETV6
Human Description:
ets variant 6 [Source:HGNC Symbol;Acc:3495]
Mouse Orthologue:
Etv6
Mouse Description:
ets variant gene 6 (TEL oncogene) Gene [Source:MGI Symbol;Acc:MGI:109336]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4239 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100501 Essential Splice Site 12 206 1 5
Genomic Location:
Chromosome 23 (position 5241622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGGTTAAAGAACATGAGTGACGCCTCTTCACCGCCACCTTTAATAAAG[G/A]TAAGTYMTCTGGTAGATACACAACAAGCTTACTGGGAAAGTACAGTATGY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s8kes10n