celsr1a

Ensembl ID:
ENSDARG00000069185
ZFIN ID:
ZDB-GENE-030616-78
Description:
SI:bZ6L08.1 (Novel protein similar to human cadherin, EGF LAG seven-pass G-type receptor (CELSR)) [S
Human Orthologues:
CELSR1, CELSR2, CELSR3
Human Descriptions:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologues:
Celsr1, Celsr2, Celsr3
Mouse Descriptions:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7553 Missense Mutation detected in F1 DNA During 2015
sa18077 Nonsense Available for shipment Available now
sa26316 Nonsense Mutation detected in F1 DNA During 2015
sa26315 Nonsense Mutation detected in F1 DNA During 2015
sa6951 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa7553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000187 Missense 26 1767 1 34
ENSDART00000043737   None 1224 None 26
ENSDART00000123617   None 1664 None 35
Genomic Location:
Chromosome 4 (position 27589314)
KASP Assay ID:
554-4345.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTACTCTCCGTGTCACCATCATCACTGATGAGATGCTAACAAACAGCA[T/G]CACAGTCCGTCTGGAGAACATGTCCCAGGAACGCTTCCTATCCCCACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000187   None 1767 None 34
ENSDART00000043737   None 1224 None 26
ENSDART00000123617 Nonsense 284 1664 6 35
Genomic Location:
Chromosome 4 (position 27543073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATGAGRAACCTGACAATTGACAGTAAATCARTTGACATGGCCAGTTA[C/A]ATTGCCAACAAWGGCACTACCGAAGGTTAGCCACAAATCATTACATTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000187   None 1767 None 34
ENSDART00000043737 Nonsense 62 1224 2 26
ENSDART00000123617 Nonsense 397 1664 9 35
Genomic Location:
Chromosome 4 (position 27533171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTATATGTTTATATACCATGATTTTTTTTTTAAGATAAGAGACAAGTA[T/A]GTGCAGTTTGAAGTGCTTCTCGGAGAGCAGAAGGTGGCCGTGCTGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000187 Nonsense 822 1767 15 34
ENSDART00000043737 Nonsense 392 1224 8 26
ENSDART00000123617 Nonsense 727 1664 15 35
Genomic Location:
Chromosome 4 (position 27527399)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGTGGCCCAGGACTAATTTTGGTTTCCCTGTGGCAATGAATTGCCCC[A/T]AGGGATCTATTGGTGAGTGAAACAGGCCTTTTTATCTTCACAAAATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000187 Nonsense 1333 1767 25 34
ENSDART00000043737 Nonsense 866 1224 18 26
ENSDART00000123617 Nonsense 1250 1664 26 35
Genomic Location:
Chromosome 4 (position 27514114)
KASP Assay ID:
554-5223.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTGTGGGTTTGGATCCGCAAGGATATGGCAACCCTGACTTCTGCTG[G/A]CTGTCCGTCCACGACACCCTCATCYGGAGTTTTGCTGGACCCATCGCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dkxds371