taar13b

Ensembl ID:
ENSDARG00000069177
ZFIN ID:
ZDB-GENE-041014-65
Description:
trace amine associated receptor 13b [Source:RefSeq peptide;Acc:NP_001076511]
Mouse Orthologue:
Taar4
Mouse Description:
trace amine-associated receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2685072]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39306 Nonsense Mutation detected in F1 DNA During 2016
sa14694 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060799 Nonsense 51 341 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46142037)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46279936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTATCTCGTATTGGCGTCAGCAATGACTGTGACCGTTCTAGGAAATT[C/A]AGTGGTCATTATTTCTATAGCACACTTTAAACAGCTCCAGACACCGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060799 Nonsense 251 341 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46141438)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46280535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCAAACCCGAATGAAAATGWGAATCTGTTTAAAAGCTCTMGGCGATCT[G/T]AMAGAAAAGCAGCAAAGACACWTGGTATWRTYGTGGGTGCTTTTATTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link