gramd4

Ensembl ID:
ENSDARG00000069171
ZFIN ID:
ZDB-GENE-041210-211
Description:
Novel protein similar to mouse cDNA sequence BC021523 (BC021523) [Source:UniProtKB/TrEMBL;Acc:Q5RIP4
Human Orthologue:
GRAMD4
Human Description:
GRAM domain containing 4 [Source:HGNC Symbol;Acc:29113]
Mouse Orthologue:
Gramd4
Mouse Description:
GRAM domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2676308]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40309 Nonsense Mutation detected in F1 DNA During 2017
sa2167 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa40309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042576 Nonsense 12 480 1 16
ENSDART00000100465 Nonsense 12 488 1 17
ENSDART00000134605 Nonsense 111 586 3 18
Genomic Location (Zv9):
Chromosome 4 (position 27389755)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28104095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCACTTTTTTATCATTTTAGAGGAGGAATTACGGAAGCTACGAGAA[G/T]AAACCAATGTGGAAACCCTTAAGCAGGAGCTGGAAAGAGAGCGCAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2167
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042576 Essential Splice Site 403 480 13 16
ENSDART00000100465 Essential Splice Site 403 488 14 17
ENSDART00000134605 Essential Splice Site 501 586 15 18
Genomic Location (Zv9):
Chromosome 4 (position 27365523)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28079584
KASP Assay ID:
554-3222.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGCCCACTGAYTACATCCGCAAYGGGATGCTCTACGTCACTGAGAA[G/A]TAAGAAACATCTGCTTTTATCCCTGACAAATCTACTGAGATTGAAGTTST
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link