cerk

Ensembl ID:
ENSDARG00000069169
ZFIN ID:
ZDB-GENE-041210-210
Description:
ceramide kinase [Source:RefSeq peptide;Acc:NP_001099056]
Human Orthologue:
CERK
Human Description:
ceramide kinase [Source:HGNC Symbol;Acc:19256]
Mouse Orthologue:
Cerk
Mouse Description:
ceramide kinase Gene [Source:MGI Symbol;Acc:MGI:2386052]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20295 Essential Splice Site, Missense Available for shipment Available now
sa33481 Nonsense Mutation detected in F1 DNA During 2016
sa26314 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18020 Essential Splice Site Available for shipment Available now
sa10769 Nonsense Available for shipment Available now
sa33482 Nonsense Mutation detected in F1 DNA During 2016
sa33483 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Essential Splice Site 183 568 5 13
ENSDART00000146099 Missense 264 649 5 13
Genomic Location (Zv9):
Chromosome 4 (position 27222044)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27936105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTATCATCAACCTGGTAACAATGGCTTTTCCCTTTTTGTTTCTATA[G/A]TTACAGAGCATGCAAATCATGCCAGAGACCACTTGAAGGCAGAGGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Nonsense 203 568 5 13
ENSDART00000146099 Nonsense 284 649 5 13
Genomic Location (Zv9):
Chromosome 4 (position 27222106)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27936167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAATCATGCCAGAGACCACTTGAAGGCAGAGGCTGATCTGAAGAAGTA[T/A]GATGGGTAAGTGGATGTCCTGCTGTGGGATATCACGGTCACTGTGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Essential Splice Site 279 568 7 13
ENSDART00000146099 Essential Splice Site 360 649 7 13
Genomic Location (Zv9):
Chromosome 4 (position 27233762)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27947823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTTGGCTCAAATGACCCCGTCACCTCAGCGCTGCACATGGTCGTGGG[T/A]AAGTGAGCATCTTCATATTAGCTGTATGAGACGCGTTTAGTTATGCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Essential Splice Site 279 568 8 13
ENSDART00000146099 Essential Splice Site 360 649 8 13
Genomic Location (Zv9):
Chromosome 4 (position 27235157)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27949218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTGTGTTTTGTTTTGTGCTTTCCATAAATYCATTCTGTCATTTTCCAYA[G/A]GTGATTCTCAACCAATGGATGTCTGCTCAGTGCACAGCGATGATCGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Nonsense 303 568 8 13
ENSDART00000146099 Nonsense 384 649 8 13
Genomic Location (Zv9):
Chromosome 4 (position 27235230)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27949291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCAGTGCACAGCGATGATCGTTTCCTGCGTTACTCTGTCTCACTGT[T/A]GGGTTATGGTTTCTATGGAGAWGTGCTAAAAGACAGCGAGAGGAAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Nonsense 363 568 9 13
ENSDART00000146099 Nonsense 444 649 9 13
Genomic Location (Zv9):
Chromosome 4 (position 27235492)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27949553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTACCTGCAGAAGAGAACTTGGGAACTCCAAGAGACAAAGTGCAGTGT[C/T]GATCTGGGTAAATGCTATACTTTGTTCCATGTTTAAGCATAATATGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Nonsense 451 568 11 13
ENSDART00000146099 Nonsense 532 649 11 13
Genomic Location (Zv9):
Chromosome 4 (position 27242728)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27956789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCTCGTCAGAAAGTGCTCCAGAGTCGACTTCCTGCGACACCTGCTG[C/T]GACACACCAATAAGAAGGACCAGGTTAATATCTCAACAGAATAAATCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link