cerk

Ensembl ID:
ENSDARG00000069169
ZFIN ID:
ZDB-GENE-041210-210
Description:
ceramide kinase [Source:RefSeq peptide;Acc:NP_001099056]
Human Orthologue:
CERK
Human Description:
ceramide kinase [Source:HGNC Symbol;Acc:19256]
Mouse Orthologue:
Cerk
Mouse Description:
ceramide kinase Gene [Source:MGI Symbol;Acc:MGI:2386052]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20295 Essential Splice Site, Missense Available for shipment Available now
sa18020 Essential Splice Site Available for shipment Available now
sa10769 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Essential Splice Site 183 568 5 13
ENSDART00000146099 Missense 264 649 5 13
Genomic Location:
Chromosome 4 (position 27222044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTATCATCAACCTGGTAACAATGGCTTTTCCCTTTTTGTTTCTATA[G/A]TTACAGAGCATGCAAATCATGCCAGAGACCACTTGAAGGCAGAGGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Essential Splice Site 279 568 8 13
ENSDART00000146099 Essential Splice Site 360 649 8 13
Genomic Location:
Chromosome 4 (position 27235157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTGTGTTTTGTTTTGTGCTTTCCATAAATYCATTCTGTCATTTTCCAYA[G/A]GTGATTCTCAACCAATGGATGTCTGCTCAGTGCACAGCGATGATCGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100453 Nonsense 303 568 8 13
ENSDART00000146099 Nonsense 384 649 8 13
Genomic Location:
Chromosome 4 (position 27235230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCAGTGCACAGCGATGATCGTTTCCTGCGTTACTCTGTCTCACTGT[T/A]GGGTTATGGTTTCTATGGAGAWGTGCTAAAAGACAGCGAGAGGAAGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3uwhv307