tmem135

Ensembl ID:
ENSDARG00000069157
ZFIN ID:
ZDB-GENE-070424-70
Description:
transmembrane protein 135 [Source:RefSeq peptide;Acc:NP_001082887]
Human Orthologue:
TMEM135
Human Description:
transmembrane protein 135 [Source:HGNC Symbol;Acc:26167]
Mouse Orthologue:
Tmem135
Mouse Description:
transmembrane protein 135 Gene [Source:MGI Symbol;Acc:MGI:1920009]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4374 Nonsense Mutation detected in F1 DNA During 2014
sa16243 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100430 Nonsense 235 465 8 15
ENSDART00000123820 Nonsense 235 465 8 15
Genomic Location:
Chromosome 10 (position 25955851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCAAACACCTGCCTCTAGAGGGAGCTGCATCAGAGCTTTTGCACGT[A/T]AACTCCTAGACTCTTTGTAAGTGTCGCAGATAAACTAGCTTATGTTTYAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100430 Essential Splice Site 340 465 11 15
ENSDART00000123820 Essential Splice Site 340 465 11 15
Genomic Location:
Chromosome 10 (position 25953553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAGATGGATGCGCAACCTGGATGATGAGCTCCACGCGCTTATAGCAG[G/A]TAAATTGTGAKTTGAACAGATGAATTTNAACATCTTATTAGAGGTCCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/thqqfhg6