aars

Ensembl ID:
ENSDARG00000069142
ZFIN ID:
ZDB-GENE-030131-3663
Description:
alanyl-tRNA synthetase, cytoplasmic isoform 2 [Source:RefSeq peptide;Acc:NP_001035124]
Human Orthologue:
AARS
Human Description:
alanyl-tRNA synthetase [Source:HGNC Symbol;Acc:20]
Mouse Orthologue:
Aars
Mouse Description:
alanyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2384560]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9719 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076695 None None 433 None 10
ENSDART00000100401 Nonsense 613 966 14 21
ENSDART00000100425 Nonsense 613 757 14 17
ENSDART00000123557 Nonsense 638 991 14 21
ENSDART00000128265 Nonsense 613 746 15 17
ENSDART00000136544 Nonsense 638 991 15 22
Genomic Location:
Chromosome 18 (position 18426067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRTCGTAGGCCGATCATGAGTAACCACACAGCCACACACATCCTGAACTA[C/A]GGCCTGCGTTCAGTTCTYGGAGAAGCRGATCAGCGAGGCTCTTTGGTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hgjd2nw3