ppp2r5eb

Ensembl ID:
ENSDARG00000069118
ZFIN ID:
ZDB-GENE-030904-6
Description:
serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit epsilon isoform [Source:RefSeq pe
Human Orthologue:
PPP2R5E
Human Description:
protein phosphatase 2, regulatory subunit B', epsilon isoform [Source:HGNC Symbol;Acc:9313]
Mouse Orthologue:
Ppp2r5e
Mouse Description:
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35564 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2677 Essential Splice Site F2 line generated During 2017
sa22360 Essential Splice Site Available for shipment Available now
sa13799 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100324 Essential Splice Site None 467 None 15
ENSDART00000123376   None 467 None 13
ENSDART00000147336   None 134 1 4
Genomic Location (Zv9):
Chromosome 13 (position 37862712)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37339524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTTGGATACAAATAACCTGCAAACGCGGCGTGTGGATATAAAGAGG[T/C]ACCCGGGGATGTTCGTATTTCAGCTGGATCTATTTCTATCGTCGGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2677
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100324 Essential Splice Site None 467 3 15
ENSDART00000123376   None 467 None 13
ENSDART00000147336 Essential Splice Site None 134 2 4
Genomic Location (Zv9):
Chromosome 13 (position 37853765)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37330577
KASP Assay ID:
554-2498.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGCTGCTGYGTTTATGTTGTCTTACATGTCTTTTTCCCTATTTTTTT[A/T]GGGCTATGTCCTCCGCAGCCACCACTCCTCCATCAGTGGATAAAGTAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100324 Essential Splice Site 184 467 7 15
ENSDART00000123376 Essential Splice Site 184 467 5 13
ENSDART00000147336   None 134 None 4
Genomic Location (Zv9):
Chromosome 13 (position 37826788)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37303600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAAGTAGTGTTTGTTGTTTATCTTTTTGTTCATCTGTCTTTCTCTCA[G/A]CTGCTGGAGTTGTTCGACAGCGAGGACCCACGAGAAAGAGATTACCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100324 Nonsense 399 467 13 15
ENSDART00000123376 Nonsense 399 467 11 13
ENSDART00000147336   None 134 None 4
Genomic Location (Zv9):
Chromosome 13 (position 37821102)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37297914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTTCCAATAATGTTCGCCAGTCTTTACCGGATCTCCAAAGAACACTG[G/A]AACCCGTGAGTCAAACCTACACCACCAACACAATCTCTCAGCCTATAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link