si:ch211-251m13.1

Ensembl ID:
ENSDARG00000069117
ZFIN ID:
ZDB-GENE-090311-23
Description:
Novel protein similar to H.sapiens KCNH5, potassium voltage-gated channel, subfamily H (Eag-related)
Human Orthologue:
KCNH5
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 5 [Source:HGNC Symbol;Acc:6254]
Mouse Orthologue:
Kcnh5
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 5 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31956 Nonsense Available for shipment Available now
sa10517 Nonsense Available for shipment Available now
sa35563 Nonsense Mutation detected in F1 DNA During 2017
sa15450 Nonsense Available for shipment Available now
sa22359 Nonsense Available for shipment Available now
sa13966 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 146 994 5 12
ENSDART00000138934 Nonsense 146 675 5 10
Genomic Location (Zv9):
Chromosome 13 (position 37767458)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37244270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAATGTATTATGTGTCTTTCACTCAGTACGTAAATATCTTTTAGGTT[G/A]GACCAAGTTTGCACGTTTGACTCGAGCGTTGACCAACAGCAAAAGCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 305 994 6 12
ENSDART00000138934 Nonsense 304 675 6 10
Genomic Location (Zv9):
Chromosome 13 (position 37762608)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37239420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTACCTCAAGACCTGGTTCGTTATAGACTTGCTGTCCTGTCTGCCCTA[T/G]GACATCATCAAYGCWTTTGAAAACGTGGATGAGGTGAGCGGACCTGTYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 390 994 7 12
ENSDART00000138934 Nonsense 389 675 7 10
Genomic Location (Zv9):
Chromosome 13 (position 37748021)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37224833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTATGAGGTCATTGACGAACAAACCAACACCATCAAGACTGACAGCTG[G/A]CTCTTCCAGTTAGCCACCAGCATCGGGTCCCCGTACCGCTACAATGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 718 994 11 12
ENSDART00000138934   None 675 None 10
Genomic Location (Zv9):
Chromosome 13 (position 37700745)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37177557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCACCATTCCTGTGGACCATCCAGTCCGAAAACTTTTCCAGAAGTTT[A/T]AGCAGCAGAAAGAGCTCAGAAACCAGGGCGCTTCAGCCCAGCTGGACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 945 994 12 12
ENSDART00000138934   None 675 None 10
Genomic Location (Zv9):
Chromosome 13 (position 37700025)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37176837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGATGGAGATCCAGGCTCTGAACGGAAGGATGGCAACTTTGGAAGAA[C/T]GAGTCGGACAAATTCTCAGACTTCTTTTAGACTCTTCGAAAGCCAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100322 Nonsense 957 994 12 12
ENSDART00000138934   None 675 None 10
Genomic Location (Zv9):
Chromosome 13 (position 37699988)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37176800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTTGGAAGAACGAGTCGGACAAATTCWCAGACTTCTTTTAGACTCTT[C/A]GAAAGCCAAGTCTAGTGAAGACTTGACTCATAGACCCAAACTCAAAKCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link