A7MBX7_DANRE

Ensembl ID:
ENSDARG00000069114
Description:
LOC100000934 protein [Source:UniProtKB/TrEMBL;Acc:A7MBX7]
Human Orthologues:
AL592170.3, UNC93B1
Human Description:
unc-93 homolog B1 (C. elegans) [Source:HGNC Symbol;Acc:13481]
Mouse Orthologue:
Unc93b1
Mouse Description:
unc-93 homolog B1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1859307]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31223 Nonsense Available for shipment Available now
sa38286 Nonsense Mutation detected in F1 DNA During 2016
sa12422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025145 Nonsense 397 623 9 12
Genomic Location (Zv9):
Chromosome 1 (position 44866311)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43709530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCTGTGGCTGTTGGTTATGGTGTACGGTTTGTCATCCTCCATCTGTT[C/A]GGCTCTTGCTTTGGCATTGTTGCGATTGCCCAGGCCCGTTATTCTCCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025145 Nonsense 483 623 10 12
Genomic Location (Zv9):
Chromosome 1 (position 44866950)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43710169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTATGAGGACAAGGAGCGACTGGACTTTGTTTACACCATCTATCATTG[G/A]TGGCAAGCTATTGCCATCTTCATCGTCTACCTCTGGTCTGCATTACCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025145 Nonsense 518 623 11 12
Genomic Location (Zv9):
Chromosome 1 (position 44869924)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43713143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAGCTGGGGCTGCTGTTGTTGACTCTCCTAGTGGCGTCTCTCTGTTA[C/A]GTGCAGATGGAGCGACGTCTGGCCAAGAAAATTCCCTTCAGGTTGCCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link