A7MBX7_DANRE

Ensembl ID:
ENSDARG00000069114
Description:
LOC100000934 protein [Source:UniProtKB/TrEMBL;Acc:A7MBX7]
Human Orthologues:
AL592170.3, UNC93B1
Human Description:
unc-93 homolog B1 (C. elegans) [Source:HGNC Symbol;Acc:13481]
Mouse Orthologue:
Unc93b1
Mouse Description:
unc-93 homolog B1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1859307]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025145 Nonsense 518 623 11 12
Genomic Location:
Chromosome 1 (position 44869924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAGCTGGGGCTGCTGTTGTTGACTCTCCTAGTGGCGTCTCTCTGTTA[C/A]GTGCAGATGGAGCGACGTCTGGCCAAGAAAATTCCCTTCAGGTTGCCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4c5z5740