fgfr4

Ensembl ID:
ENSDARG00000069105
ZFIN ID:
ZDB-GENE-980526-488
Description:
Fibroblast growth factor receptor 4 [Source:UniProtKB/Swiss-Prot;Acc:Q90413]
Human Orthologue:
FGFR4
Human Description:
fibroblast growth factor receptor 4 [Source:HGNC Symbol;Acc:3691]
Mouse Orthologue:
Fgfr4
Mouse Description:
fibroblast growth factor receptor 4 Gene [Source:MGI Symbol;Acc:MGI:95525]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3514 Nonsense Confirmed mutation in F2 line Unknown
sa24005 Nonsense Mutation detected in F1 DNA During 2014
sa4147 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6682 Nonsense Mutation detected in F1 DNA During 2014
sa24004 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu3514
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Nonsense 43 922 3 20
Genomic Location:
Chromosome 21 (position 36516834)
KASP Assay ID:
554-0053.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTCCAGCAGATATCAGAGTTTCACGACACATACTTACTCCTGGATA[T/A]CCTGAGAATGCTACTGTGTTGGTCGGAGGACATGTGAAGCTGGTGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Nonsense 173 922 5 20
Genomic Location:
Chromosome 21 (position 36516140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGTACTTAAACTCCGTTGTGACACAAACCGTCCTGGAGCTGTCCAGT[G/A]GTTCAAGAGTGGTGTTCGGGTGCAACACAATGCCCGTATCCAGATAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Essential Splice Site 312 922 7 20
Genomic Location:
Chromosome 21 (position 36515549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAATGGCAGAGAATTCCGAGGAGAGCACAGGATTGGTGGCATCAAGG[T/C]GAAAGATTTTTAATCTATTGGAGGCTTAGCAMTGGCTTGAACTTCTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Nonsense 405 922 9 20
Genomic Location:
Chromosome 21 (position 36514493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCTCACATCCAGTGGCTCAAGCRTATAGAAATGAATGGCAGCCGTTA[T/A]GGGCCTGATGGCATTCCTTATGTGAAGATTGTGAAGGTATATAGGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100286 Essential Splice Site 577 922 13 20
Genomic Location:
Chromosome 21 (position 36513599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTCATGTAATGGTGAACTAACTAGTTATTTAAATTCTCTCATGCCA[G/A]TTTGACTTTAGGGAAACCGCTTGGAGAGGGTTGCTTTGGTCAAGTGGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j48ilmm8