tmco1

Ensembl ID:
ENSDARG00000069099
ZFIN ID:
ZDB-GENE-050417-344
Description:
transmembrane and coiled-coil domains 1 [Source:RefSeq peptide;Acc:NP_001002575]
Human Orthologue:
TMCO1
Human Description:
transmembrane and coiled-coil domains 1 [Source:HGNC Symbol;Acc:18188]
Mouse Orthologue:
Tmco1
Mouse Description:
transmembrane and coiled-coil domains 1 Gene [Source:MGI Symbol;Acc:MGI:1921173]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11208 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100276 Essential Splice Site 24 188 None 7
ENSDART00000127371 None None 184 1 6

The following transcripts of ENSDARG00000069099 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 21648071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGATCCTGATCGTTTTTATATCTATTTGYACAGCACTATTAGCGGAAGG[T/A]ATGTAAACACTGTCGTGATWWTCAGTTTTACATGTCAAAGCAGTWAGCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Glaucoma: Genome-wide association study identifies susceptibility loci for open angle glaucoma at TMCO1 and CDKN2B-AS1. (View Study)
  • Intraocular pressure: Common genetic determinants of intraocular pressure and primary open-angle glaucoma. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/whjgwypv