gls2

Ensembl ID:
ENSDARG00000069095
ZFIN ID:
ZDB-GENE-081105-57
Description:
Novel protein similar to glutaminase (Gls) [Source:UniProtKB/TrEMBL;Acc:B0S7X7]
Human Orthologue:
GLS2
Human Description:
glutaminase 2 (liver, mitochondrial) [Source:HGNC Symbol;Acc:29570]
Mouse Orthologue:
Gls2
Mouse Description:
glutaminase 2 (liver, mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:2143539]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21269 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100266 Nonsense 64 613 1 18
ENSDART00000139257 Nonsense 64 605 1 18
Genomic Location:
Chromosome 8 (position 21722544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATCCTCGCCAGCAGCACGCTGTCAATGAGACTGACGCCGCGACGTA[C/A]AGGTAATAAATCCCCTGACAAATAGATAATAAATATACTTTTTAACAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wr59fs1b