col2a1a

Ensembl ID:
ENSDARG00000069093
ZFIN ID:
ZDB-GENE-980526-192
Description:
collagen alpha-1(II) chain [Source:RefSeq peptide;Acc:NP_571367]
Human Orthologue:
COL2A1
Human Description:
collagen, type II, alpha 1 [Source:HGNC Symbol;Acc:2200]
Mouse Orthologue:
Col2a1
Mouse Description:
collagen, type II, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88452]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34379 Nonsense Mutation detected in F1 DNA During 2016
sa34380 Nonsense Mutation detected in F1 DNA During 2016
sa21270 Essential Splice Site Mutation detected in F1 DNA During 2016
sa532 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091307   None 1421 None 53
ENSDART00000100234 Nonsense 44 1491 2 54
Genomic Location (Zv9):
Chromosome 8 (position 21736267)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21166164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGTGGCTGCAGAGGAAGAGTTTGGCGGCTGTGTTCAAGATGGCCAG[C/T]AGTATGCAGACCGTGCGGTTTGGAAACCAGAACCGTGCCGTGTCTGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091307 Nonsense 162 1421 9 53
ENSDART00000100234 Nonsense 232 1491 10 54
Genomic Location (Zv9):
Chromosome 8 (position 21740855)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21170752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTCATTTGTTTCCATTCCAGGGCCCACAAGGTTTCCAAGGCAACCCT[G/T]GAGAGACTGGTGAACCCGGCCCTGCTGTGAGTGGCCCATATCTCGATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091307 Essential Splice Site 170 1421 9 53
ENSDART00000100234 Essential Splice Site 240 1491 10 54
Genomic Location (Zv9):
Chromosome 8 (position 21740883)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21170780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGGTTTCCAAGGCAACCCTGGAGAGACTGGTGAACCCGGCCCTGCTG[T/C]GAGTGGCCCATATCTCGATTTCCTGCACATGCCTACGCATATGACACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091307 Essential Splice Site 632 1421 31 53
ENSDART00000100234 Essential Splice Site 702 1491 32 54
Genomic Location (Zv9):
Chromosome 8 (position 21746867)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21176764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAGGGTGTTCCTGGAGAGGGTGGTGCTGCCGGTCCCACTGGACCAAGA[G/T]TGAGTTTCTATCCTTCACTAAGAAGACCCCCAATACAACTTAGTGTGAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link