xrn2

Ensembl ID:
ENSDARG00000069092
ZFIN ID:
ZDB-GENE-040426-2874
Description:
5'-3' exoribonuclease 2 [Source:RefSeq peptide;Acc:NP_001001944]
Human Orthologue:
XRN2
Human Description:
5'-3' exoribonuclease 2 [Source:HGNC Symbol;Acc:12836]
Mouse Orthologue:
Xrn2
Mouse Description:
5'-3' exoribonuclease 2 Gene [Source:MGI Symbol;Acc:MGI:894687]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100239   None 540 None 18
ENSDART00000100246 Nonsense 721 952 24 31
ENSDART00000137314   None 273 None 9
ENSDART00000146596   None 540 25 32
Genomic Location:
Chromosome 20 (position 49038968)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCARTAATTTCCCAATCTTTCTCTTYAAGGCCACTGAGATCCCTGCA[G/T]AGTTTTGTCRTGGAATCCAAGGTATATTAAATCTTGATGAAGACCCTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pdty27bl