xrn2

Ensembl ID:
ENSDARG00000069092
ZFIN ID:
ZDB-GENE-040426-2874
Description:
5'-3' exoribonuclease 2 [Source:RefSeq peptide;Acc:NP_001001944]
Human Orthologue:
XRN2
Human Description:
5'-3' exoribonuclease 2 [Source:HGNC Symbol;Acc:12836]
Mouse Orthologue:
Xrn2
Mouse Description:
5'-3' exoribonuclease 2 Gene [Source:MGI Symbol;Acc:MGI:894687]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100239 None None 540 None 18
ENSDART00000100246 Nonsense 721 952 24 31
ENSDART00000137314 None None 273 None 9
ENSDART00000146596 None None 540 25 32
Genomic Location:
Chromosome 20 (position 49038968)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCARTAATTTCCCAATCTTTCTCTTYAAGGCCACTGAGATCCCTGCA[G/T]AGTTTTGTCRTGGAATCCAAGGTATATTAAATCTTGATGAAGACCCTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pdty27bl