xrn2

Ensembl ID:
ENSDARG00000069092
ZFIN ID:
ZDB-GENE-040426-2874
Description:
5'-3' exoribonuclease 2 [Source:RefSeq peptide;Acc:NP_001001944]
Human Orthologue:
XRN2
Human Description:
5'-3' exoribonuclease 2 [Source:HGNC Symbol;Acc:12836]
Mouse Orthologue:
Xrn2
Mouse Description:
5'-3' exoribonuclease 2 Gene [Source:MGI Symbol;Acc:MGI:894687]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37162 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100239 Essential Splice Site 356 540 11 18
ENSDART00000100246 Essential Splice Site 356 952 11 31
ENSDART00000137314 Essential Splice Site 80 273 3 9
ENSDART00000146596 Essential Splice Site 356 540 11 32
Genomic Location:
Chromosome 20 (position 49008408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTGTGGGAAATGACTTCTTGCCCCACTTACCGTCTCTTGAGATCAGG[T/C]ACGCTCCCAAAAACACTTTATCTCTTCTGTATGCTCTGCAGTGAGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100239   None 540 None 18
ENSDART00000100246 Nonsense 721 952 24 31
ENSDART00000137314   None 273 None 9
ENSDART00000146596   None 540 25 32
Genomic Location:
Chromosome 20 (position 49038968)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCARTAATTTCCCAATCTTTCTCTTYAAGGCCACTGAGATCCCTGCA[G/T]AGTTTTGTCRTGGAATCCAAGGTATATTAAATCTTGATGAAGACCCTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link