ints2

Ensembl ID:
ENSDARG00000069085
ZFIN ID:
ZDB-GENE-050522-148
Description:
integrator complex subunit 2 [Source:RefSeq peptide;Acc:NP_001018378]
Human Orthologue:
INTS2
Human Description:
integrator complex subunit 2 [Source:HGNC Symbol;Acc:29241]
Mouse Orthologue:
Ints2
Mouse Description:
integrator complex subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1917672]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31784 Essential Splice Site Available for shipment Available now
sa8636 Nonsense Mutation detected in F1 DNA During 2017
sa21754 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023545   None 167 None 3
ENSDART00000078791 Essential Splice Site 219 1210 4 24
ENSDART00000143487 Essential Splice Site 216 1206 5 25
Genomic Location (Zv9):
Chromosome 10 (position 28707093)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28138687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTTCTCTGCCTTCTGGTGGCAAATGTCCCGGACAGCTTCAATGAAG[G/A]TATGTTCATCACCTACTATGAGTCTAATCTGTACATTTGATTTTTAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023545   None 167 None 3
ENSDART00000078791 Nonsense 335 1210 7 24
ENSDART00000143487 Nonsense 332 1206 8 25
Genomic Location (Zv9):
Chromosome 10 (position 28699985)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28131579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTCAGAGAAAAAGAGAGAGCAGTTCGGTGCTGTGGCAGATGCGGAGG[C/T]AGCTGCTGTTGGAGCTGGTGGCCATTTTACCCCGYTCSCGCAGTACRCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023545   None 167 None 3
ENSDART00000078791 Essential Splice Site 436 1210 8 24
ENSDART00000143487 Essential Splice Site 433 1206 9 25
Genomic Location (Zv9):
Chromosome 10 (position 28696052)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28127646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCTCCCTGTCTTTCTGTAAACTGCTGGCGTTCCCCACTCTTGTCAGG[T/C]ACAGCTTTTTTGCTACCAATAATCCATCCTTTAAGATAAATGAGCATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link