btg3

Ensembl ID:
ENSDARG00000069065
ZFIN ID:
ZDB-GENE-031113-19
Description:
protein BTG3 [Source:RefSeq peptide;Acc:NP_001007352]
Human Orthologue:
BTG3
Human Description:
BTG family, member 3 [Source:HGNC Symbol;Acc:1132]
Mouse Orthologues:
Btg3, Gm7334
Mouse Descriptions:
B-cell translocation gene 3 Gene [Source:MGI Symbol;Acc:MGI:109532]
predicted gene 7334 Pseudogene [Source:MGI Symbol;Acc:MGI:3647393]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41682 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41681 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100207 Essential Splice Site None 159 None 5
ENSDART00000131220 Essential Splice Site None 160 None 5

The following transcripts of ENSDARG00000069065 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 29062586)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28494180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGCGAGGCAGAAGGAGTTTTCCACATGTGGATGAAAAGAAAACACGG[T/A]CAGTTTTTCTATTCCTATTTGCAGTGATAATGCGAGCTCACGTAGAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100207 Splice Site None 159 None 5
ENSDART00000131220 Essential Splice Site 154 160 4 5

The following transcripts of ENSDARG00000069065 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 29053607)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28485201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGTCACGTCGGATTACCACTCTGGATCCTCCTCAGATGAAGACATCAG[C/T]TGTAGGGAGATCCAGTATACGACACCTCTTCACAACCAGCCTCCTTACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link