glula

Ensembl ID:
ENSDARG00000069054
ZFIN ID:
ZDB-GENE-030131-688
Description:
glutamine synthetase 1 [Source:RefSeq peptide;Acc:NP_853537]
Human Orthologue:
GLUL
Human Description:
glutamate-ammonia ligase [Source:HGNC Symbol;Acc:4341]
Mouse Orthologue:
Glul
Mouse Description:
glutamate-ammonia ligase (glutamine synthetase) Gene [Source:MGI Symbol;Acc:MGI:95739]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1387 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1387
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100170 Nonsense 149 371 4 7

The following transcripts of ENSDARG00000069054 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 19462092)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19341228
KASP Assay ID:
554-1299.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGAGCAGGAGTACACTATTCTGGGTACTGACGGACACCCCTTTGGTTG[G/A]CCTTCSAATGGGTTTCCTGGTCCTCAAGGTAAGAATGTGCCCTTTTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link