serpinf1

Ensembl ID:
ENSDARG00000069048
ZFIN ID:
ZDB-GENE-040912-2
Description:
pigment epithelium-derived factor [Source:RefSeq peptide;Acc:NP_001004539]
Human Orthologue:
SERPINF1
Human Description:
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member
Mouse Orthologue:
Serpinf1
Mouse Description:
serine (or cysteine) peptidase inhibitor, clade F, member 1 Gene [Source:MGI Symbol;Acc:MGI:108080]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39347 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100166 Nonsense 359 406 8 8
Genomic Location (Zv9):
Chromosome 21 (position 38955741)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40095806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATGCAGTCCATCATAAGGTTGTCCTGGAGACAGCTCCAGAGGGCGCA[G/T]AGTATGCCAGCACCACACCCAGTGCCACAGGTCAATCGCTGGGTCTATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Calcium levels: Common variants in the calcium-sensing receptor gene are associated with total serum calcium levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link