ENSDARG00000069046

Ensembl ID:
ENSDARG00000069046

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14995 Essential Splice Site Available for shipment Available now
sa4873 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa14995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100163 Essential Splice Site 283 585 4 8
Genomic Location:
Chromosome 1 (position 59913012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGGCCCTCGGGCAGGAGCGCASYGCCATCAGAGACRCACACCAGCAG[G/A]TCAGCAGCGATTCACAGWACTKATGAGTCACTCCTGAAYGATTCTTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4873
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100163 Nonsense 309 585 5 8
Genomic Location:
Chromosome 1 (position 59912643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGGAACGGTGACGGTGGATGTGAAGGAGATCGAGAGCGCTGACCTGT[C/A]GCGGGTGATAGCCGAGATCCGCTCCGARTACGAGACGGCCATCGAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/og8z864t