ENSDARG00000069046

Ensembl ID:
ENSDARG00000069046

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14995 Essential Splice Site Available for shipment Available now
sa4873 Nonsense F2 line generated During 2016
sa39730 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100163 Essential Splice Site 283 585 4 8
Genomic Location:
Chromosome 1 (position 59913012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGGCCCTCGGGCAGGAGCGCASYGCCATCAGAGACRCACACCAGCAG[G/A]TCAGCAGCGATTCACAGWACTKATGAGTCACTCCTGAAYGATTCTTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4873
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100163 Nonsense 309 585 5 8
Genomic Location:
Chromosome 1 (position 59912643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGGAACGGTGACGGTGGATGTGAAGGAGATCGAGAGCGCTGACCTGT[C/A]GCGGGTGATAGCCGAGATCCGCTCCGARTACGAGACGGCCATCGAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100163 Nonsense 350 585 6 8
Genomic Location:
Chromosome 1 (position 59912434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGAATCAACAGATGGAGCAGAAGCAGGCGGAGACGGAGCTGATCACA[G/T]AGACCACGGTCAGCGGCAGCTCCGAGATCACCGACAGCAGAAAACAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link